Other InlA-truncated strains (Lma13, Lma15, Lma20, and Lma28) were sequenced at the same loci. The primers for PCR amplification and Sanger sequencing were designed using ABI PRISM Primer Express v2.0.0 (Life Ganetespib price Technologies, Carlsbad, CA, USA) (Table 3).

The PCR reaction mixture, prepared in 50 μL, contained 10 mM Tris–HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 50 pmol of each primer, 2.5 mM of each dNTP, 25 ng template DNA, and 1.25 U Takara Taq DNA polymerase (Takara Bio, Shiga, Japan). The PCR program consisted of 94°C for 4 min; 30 cycles of 94°C for 30 sec, annealing temperature for 30 sec, and 72°C 2 min; and 72°C for 4 min (Table 3). The PCR products were purified using Agencourt AMPure (Beckman Coulter, Brea, CA, USA). Sanger sequencing was conducted using an Applied Biosystems 3130 Genetic Analyzer (Life

Technologies, Carlsbad, CA, USA) using a Big-Dye Terminator ver3.1 Cycle Sequencing Kit (Life Technologies, Carlsbad, CA, USA) and Agencourt CleanSEQ (Beckman Coulter, Brea, CA, USA), according to each manufacturer’s protocol. Table 3 The primers used in PCR amplification and sequencing for confirmation of the mutation Gene Forward Reverse Annealing temperature dltA AAGTAGTGCAGTTTAGGAGAGGA AGATTGTACCACCGGATGTC 58.0 gtcA TTGAGCTCTTAGTAGAACCTGAC CTGGTTTCGCTATCTCATTAG 54.5 iap CAAAATGCTACTACACACGCT GTCAAAGAATACTAAATCACCAGC 56.5 Availability of supporting data The draft genome sequences of L. monocytogenes SHP099 clinical trial strain 36-25-1 are available in DDBJ/EMBL/GenBank under accession number BASN01000001-BASN01000122. The gene sequences of other strains Lma13, Lma15, Lma20 and Lma28 are available under accession number AB845328-845343. Acknowledgements This work was supported by a Grant-in-Aid for Scientific Research (B 24380115) from the Ministry Lepirudin of Education, Science, Sports, Culture

and Technology in Japan. Electronic supplementary material Additional file 1: The alignment of inlA in EGDe and InlA truncated strains. Nucleotide sequences and amino acid sequences are shown for each strain. The numbers shown on the both sides mean the nucleotide sequence positions in the ORF of strain EGDe. The frames show identical sequences among the strains. (PDF 1 MB) References 1. Swaminathan B, Gerner-Smidt P: The epidemiology of human listeriosis. Microbes Infect 2007, 9:1236–1243.PubMedCrossRef 2. Ivanek R, Gröhn YT, Wiedmann M: Listeria monocytogenes in multiple habitats and host populations: review of available data for mathematical modeling. Foodborne Pathog Dis 2006, 3:4.CrossRef 3. Rocourt J, BenEmbarek P, Toyofuku H, Schlundt J: Quantitative risk assessment of Listeria monocytogenes in ready-to-eat foods: the FAO/WHO approach. FEMS Immunol Med Microbiol 2003, 33:263–267.CrossRef 4. U.S. Department of Health and Human Service, U.S.