GFP-positive colonies were isolated 3–4 days after infection. On average, 15–30% of ES colonies were GFP positive. 129/SVEV ES cells were cultivated on irradiated mouse embryonic fibroblasts

in DMEM containing 15% FCS, leukemia-inhibiting factor, penicillin/streptomycin, Erlotinib nmr L-glutamine and nonessential amino acids. As described above, ES cells were infected with pSico or pSicoR, GFP+ clones were isolated and tested for DPP2 kd by qRT-PCR. The clone that suppressed DPP2 expression by 90% was selected to inject into the blastocysts of pregnant mice. Only two pSicoR chimeric mice were obtained with extremely low chimerism (5–15%). Fourteen male pSico chimeric mice were obtained that differed in GFP expression. The two male mice with highest GFP expression were chosen to mate with transgenic mice that express Cre in a tissue-restricted manner. lck-Cre mice (C57BL/6, cat♯004197) 25 were purchased from Taconic Farms (Hudson, NY). All animal studies were approved by the Institutional Animal Care and Use Committee at Tufts-NEMC. Lymphocytes from thymus, spleen and lymph nodes were stained

with anti-CD4-APC and anti-CD8-PEcy5 (BD Biosciences) in PBS for 15 min at room temperature, followed by FACS calibur (BD Biosciences) analysis to determine the percentage of T-cell populations in these tissues. qRT-PCR were performed on total RNA isolated from cells (RNeasy mini kit, Qiagen), using enough mouse Dpp2 (primer pair: GGAGGCCCTGCTTGTCTTT and CACCGAACGGAAGCGATTTC; TaqMan MGB probe: 6-FAM-CTGAGCACCGGTACTATG-NFQMGB)

and PD 332991 RT-PCR reagents (♯4304971) (Applied Biosystems), and were run and analyzed on ABI 7200 sequence detection system. The probe for 18S RNA (♯4308329, Applied Biosystems) was used to normalize individual samples. The calculation is based on the relative differences ddC(t) method as described 3. Transcript levels were similarly quantitated using the murine IL-17A (Mm004369619), IFN-γ (Mm00801788), RORγt and IL-2 ABI probes. Lymphocyte single cell suspensions were generated from thymus, spleen or lymph nodes of sacrificed mice using mesh filters. CD4+ or CD8+ cells were isolated from splenocytes and lymph node cell populations, using negative selection magnetic beads CD8 enrichment and CD4 enrichment sets (♯558131 and ♯558131, BD Biosciences), according to the manufacturer’s protocol. Cells were cultured in RPMI-1640 (Gibco, Grand Island, NY), supplemented with Hepes pH 7.4, penicillin/streptomycin, L-glutamine, 2-ME (all Gibco) and 10% FCS (Atlanta Biologicals, Norcross, GA). Lymphocytes were stimulated with plate-bound anti-CD3 alone or anti-CD3 and anti-CD28 antibody (♯553238, BD Biosciences). 96-well round-bottom plates were coated with protein A for 1 h at 37°C, washed 2× with 1× PBS, followed by addition of anti-CD3 alone or anti-CD3 and anti-CD28 antibody.