It is selleck chemicals also possible that even a modest response to anti-TNF-α in these patients is due to a reduction in IL-1 activity since TNF-α induces IL-1 50. Not all patients with TRAPS respond to anakinra, and neutralizing antibodies to IL-6 receptor have been effective in reducing disease activity, as reported in a single patient 51. Several trials have shown the benefit of anakinra in treating the signs and symptoms of rheumatoid arthritis. After one full year of treatment, the reduction in disease severity in patients with rheumatoid arthritis treated with anakinra

is comparable to other treatments 52, 53. IL-1 is a potent inhibitor of proteoglycan synthesis in cartilage 54, and joint space narrowing and erosions in patients with rheumatoid arthritis treated with anakinra are clearly improved 52, 55, 56. Moreover, unlike TNF-α blocking therapies, there have been no reports of opportunistic infections, particularly reactivation of Mycobacterium tuberculosis, in patients treated with IL-1β blocking agents. In an

analysis of anakinra use in rheumatoid arthritis, Mertens and Singh 57 reviewed five trials involving 2065 anakinra-treated patients compared with 781 patients treated with placebo and reported that there was significant improvement in various clinical and biochemical markers of disease activity as well as Selleckchem VX770 in the Larsen Resveratrol radiographic scores of the anakinra-treated patients. The authors concluded

that anakinra is a relatively safe and modestly efficacious therapy for rheumatoid arthritis. Given that anakinra is injected each day and because the first weeks of anakinra injections can cause painful injection site reactions, anakinra is not as popular with patients or with rheumatologists as anti-TNF-α. By comparison, there is widespread use of anti-TNF-α agents in treating rheumatoid arthritis, which is due to both the reduction in joint inflammation as well as the rapid (within a day) reduction in the depressive effects of TNF-α on the central nervous system. For example, with the use of functional magnetic resonance imaging, it can be observed that within 24 h of an intravenous infusion of infliximab, not only is nociceptive central nervous system activity both in the thalamus and somatosensoric cortex, but also activation of the limbic system, blocked 58. These results explain the rapid and sustained feeling of well-being reported by patients receiving anti-TNF-α treatment. The efficacy and safety of anakinra was evaluated in patients with active psoriatic arthritis; anakinra led to an improvement in signs and symptoms in nine out of 19 patients; two patients had an American College of Rheumatology (ACR) score of 70 59 (an American College of Rheumatology score of 70 indicates that the patient has experienced an overall improvement of 70% in disease activity).

To confirm the generation of Tregs, we performed transfer Temsirolimus mouse experiments: CD4+ cells were isolated from PBMCs. One half

of the cells were differentiated into Tregs by co-stimulation with different APC types for 6 days. The other half was frozen at −80°C. On day 6, T cells from cultures were separated in CD25+ and CD25- cells. They were added at a ratio of 1:10 or 1:30 in 96-well flat-bottom plates to thawed CD4+ T cells, which were labeled with CFSE. Afterwards, the cell mixture was stimulated with activation beads. Cell proliferation was measured after 5 days by flow cytometry. For CFSE-labeling cells were incubated 10 min at room temperature in 0.3 μM CFSE/PBS (MolecularProbes, San Diego, CA, USA) and thereafter intensively washed. Cells were analyzed on a FACS Canto (BD). CD1a, PD-L1, CD14, ICOS-L1, PD-L2, B7-H3, B7-H4, CD80, CD86, MHCII CD40 and CD252 were stained at the cell surface. Therefore, cells were washed in PBS and stained directly with FITC, PE or APC-labeled antibodies. Overlays were done with the Weasel

v2.5 software (WEHI, Melbourne, Australia). FoxP3 expression in T cells was assessed using an anti-human FoxP3 Staining Kit (e-Biosciences, San Diego, CA, USA), including corresponding isotype controls. Cell-free supernatants were harvested and analyzed for IL-6, IL-12p40, IL-10 and TNF by commercial available ELISA kits (OptEIA; BD). About 8×106 cells were stimulated and subsequently PIK3C2G lysed in RIPA buffer (50 mM Tris-HCL, pH7.4; 1% Igepal; 0.25% sodium deoxycholate; 150 mM NaCl; 1 mM EDTA; 1 mM

PMSF; selleck inhibitor 1 μg/mL each aprotinin, leupeptin and pepstatin; 1 mM Na3VO4; and 1 mM NaF). Lysates were cleared by centrifugation at 4° for 20 min at 14 000×g. Equal amounts of the lysates were fractionated by 12% SDS-PAGE and electrotransferred to nitrocellulose membranes (Whatman Protran nitrocellulose membrane; neoLab, Heidelberg, Germany). The membranes were blocked with TBS/0.05% Tween-20/3% BSA and were blotted with the indicated antibodies. Detection was by enhanced chemiluminescence (ECL; Perkin Elmer, Groningen, Netherlands). For the analyses of the un- and phosphorylated proteins the same lysates but different membranes were used. The ChIP assay was carried out as described by Natoli and co-workers 50 modified by Bode et al. 51. One-twentieth of the immunoprecipitated DNA was used in quantitative PCR. Results were shown as percentage of input. STAT-3, STAT-1 and STAT-5 antibodies used for ChIP were acquired from Santa Cruz Biotechnology. The following primers were used for DNA quantification: PD-L1 promoter fw TGGACTGACATGTTTCACTTTCT and rev CAAGGCAGCAAATCCAGTTT. The comparison of two data groups were analyzed by Student’s t-test. We appreciate the discussions and help of Dr. K. Kubatzky and Dr. K. A. Bode and the help of Judith Bauer. This work was supported by the Collaborative Research Center (SFB) 405 (Bartz/Heeg).

The innate immune response is critical in shaping the subsequent acquired immune response. As individuals living in endemic areas are liable to be exposed to infectious cercariae on multiple occasions during domestic, recreational, or occupational water contacts, it has been suggested that repeated exposure to E/S antigens click here released by invading cercariae may modulate the host’s immune response [5]. Indeed, in an experimental murine model, multiple infection

with S. mansoni cercariae down-modulated CD4+ T-cell responses in the skin-draining lymph nodes [10]. Multiple infection also down-regulated the development of egg-specific responses in distant lymphoid tissues and modulated the size Crenolanib clinical trial of egg-induced granulomas in the liver [10]. Therefore, human immune responsiveness to larval E/S material warrants investigation. Unfortunately, human immune responses to cercarial antigens have been infrequently investigated and have been restricted to preparations comprising the soluble fraction of whole cercariae (termed CAP or SCAP) [11-15]. This preparation is dominated by cytosolic components

recovered from the disrupted cercarial bodies and is therefore not reflective of larval E/S material. Analysis of human immune responses specifically to cercarial E/S material is unprecedented. The study presented here undertook to make an initial analysis of innate/early immune responsiveness to cercarial E/S (i.e. 0–3 h RP) in a cohort of patients from an area endemic

for schistosomiasis in northern Senegal. Specifically, the early cytokine response at 24 h of whole-blood (WB) cultures stimulated with 0–3 h RP was examined. The cytokines studied (i.e. IL-8, TNFα and IL-10) were chosen as ones typically released by innate immune cells such as macrophages and monocytes upon activation. Cytokine responses were compared old between individuals who did not harbour patent schistosome infection, those infected with S. mansoni alone, and those co-infected with S. mansoni and S. haematobium to investigate whether responsiveness to larval E/S products is influenced by current infection status. We report that cercarial E/S antigens stimulated the release of greater quantities of regulatory IL-10, but not pro-inflammatory TNFα or IL-8, in participants infected with schistosomes compared with uninfected controls. This study was conducted in 2009 as part of a larger investigation (SCHISTOINIR) examining immune responses in three endemic countries [16], for which approval was obtained by the review board of the Institute of Tropical Medicine in Antwerp, the ethical committee of the Antwerp University Hospital and ‘Le Comité National d’Ethique de la Recherche en Santé’ in Dakar, Senegal. Informed and written consent were obtained from all participants; for children, informed consent was obtained from their parents or legal guardant.

At 46 days of age, the chickens in each group were challenged i.v. with 0.5 mL of a bacterial suspension containing 108 CFU/mL of E. coli O78 strain J46, which harbors the iss, tsh cvaC, and papC genes. Ferroptosis inhibitor The LD50 value of this challenge strain for i.v. infection against 5-week-old chickens is 2.9 × 107 CFU /bird. The challenged chickens were observed for 7 days, and their clinical signs scored as follows: none = 0, reluctance to walk = 1, mild depression or ataxia = 2, depression or astasia = 3, death = 4. Dead chickens were necropsied immediately on the day of death. Seven days after challenge exposure, the surviving chickens

were killed and necropsied. Macroscopic lesions were recorded and scored separately for each organ as follows: heart and pericardium (normal = 0, turbid with excessive or cloudy fluid in the pericardial cavity or partial pericarditis = 1, marked pericarditis = 2, severe pericarditis or death = 3); liver (normal = 0, small amount of fibrinous exudate = 1, marked perihepatitis = 2, severe perihepatitis or death = 3). Samples for bacteriologic examination were taken from the liver and heart of each chicken at necropsy. Twenty 19-day-old embryonated eggs

were allotted to two equal groups and immunized with AESN1331 or sterile PBS. Each egg was oriented with FK228 the large end up and a hole punched in its top with an 18-gauge needle. Using a 21-gauge needle, an inoculum of 10 μL (103 CFU) of AESN1331 per egg (or an equivalent volume of PBS) was injected into the amniotic fluid. All inoculated eggs were then hatched in the same incubator. Hatching was assessed after 21.5 days of incubation. Until exposure to challenge, the hatched chickens were monitored daily for signs of illness and for death. At 28 days of age, all chickens were challenged and assessed as described above. Fisher’s exact test was used to compare the number of dead chickens and the number of organs positive for the challenge Molecular motor strain in each group. Student’s two-tailed t-test was employed to compare the clinical and the lesion scores between experimental groups. A P value of < 0.05 was considered significant. We compared the in

vitro and in vivo properties of the mutant strain to those of the parent; results are summarized in Table 1. As with the parent, E. coli O78 antiserum agglutinated AESN1331. Colonies of the mutant were smaller than those of the parent. AESN1331 colonies were colorless on MacConkey agar, demonstrating an inability to ferment lactose. AESN1331 also was unable to ferment D-mannose, D-sorbitol, L-rhamnose, sucrose and D-melibiose, but could still ferment glucose and L-arabinose. Although the mutant had lost tryptophan deaminase activity and indole production, the strain resembled its parent in harboring β-galactosidase, lysine decarboxylase, ornithine decarboxylase, and oxidase activities while lacking arginine dihydrolase, citrate production, H2S production, urease, acetoin production, gelatinase, and ability to reduce NO3− to NO2−.

In addition, several studies have found that infants fail to discriminate between small numbers when continuous variables such as surface area and

contour length are controlled. These findings suggest that under some circumstances, infants fail to recruit either the ANS or object file representations for small sets. Here, we used a numerical change detection paradigm to assess 6-month-old infants’ ability to represent small values. In Experiment 1, infants were tested with 1 versus 3, 1 versus 2, and 2 versus 3 dots. Infants successfully discriminated 1 versus 3 and 1 versus 2, but failed with 2 versus 3. In Experiment 2, we tested whether infants could compare small and large values with a 2 versus check details 4 condition. Across both experiments, infants’ performance exhibited ratio dependence, the hallmark of the ANS. Our results indicate that infants can attend to the purely numerical attributes of small sets and that the numerical change

detection paradigm accesses ANS representations in infancy regardless of set size. “
“Forms that are nonlinguistic markers in one language (i.e., “tsk-tsk” in English) may be part of the phoneme inventory—and hence part of words—in another language. In the current paper, we demonstrate that infants’ ability to learn words containing unfamiliar language sounds is influenced by the age and vocabulary size of the infant learner, as well as by cues to the speaker’s referential intent. When referential cues were available, infants at 14 months learned words with non-native speech

Arachidonate 15-lipoxygenase sounds, but at 20 months only those infants https://www.selleckchem.com/products/AG-014699.html with smaller vocabularies succeeded. When no referential cues were present, infants at both 14 and 20 months failed to learn the same words. The implications of the relation between linguistic sophistication and non-native word learning are discussed. “
“Newborn infants preferentially orient to familiar over unfamiliar speech sounds. They are also better at remembering unfamiliar speech sounds for short periods of time if learning and retention occur after a feed than before. It is unknown whether short-term memory for speech is enhanced when the sound is familiar (versus unfamiliar) and, if so, whether the effect is further enhanced by feeding. We used a two-factorial design and randomized infants to one of four groups: prefeed-unfamiliar, prefeed-familiar, postfeed-unfamiliar, and postfeed-familiar. Memory for either familiar or unfamiliar speech (the infant’s mother saying “baby” versus a female stranger saying “beagle”) was assessed using head turning to sound in an habituation–recovery paradigm and a retention delay of 85 sec either before or after a typical milk feed. Memory for the familiar speech–voice was enhanced relative to the unfamiliar speech–voice, expressed by significantly less head turning toward the habituated sound stimulus when it was re-presented after the delay.

Despite the normal thymic atrophy associated with age [25], we observed no influence of the housing conditions on thymic cellularity (Fig. 4A). find more Knowing that different thymic populations have distinct

susceptibility to stressful conditions [30, 31], to further determine whether the housing conditions could have an impact on one of these populations, we proceeded to the analysis of the different thymic populations. The main four thymic populations [double-negative (DN, CD4−CD8−), double-positive (DP, CD4+CD8+), CD4 single-positive (CD4SP, CD4+CD8−) and CD8SP (CD4−CD8+)] were unaffected by the enrichment material (Fig. 4B). Additionally, we further dissect our analysis by determining the proportion of the four differentiation stages that constitute the DN population [CD44+CD25− (DN1), CD44+CD25+ (DN2), CD44−CD25+ (DN3), CD44−CD25− (DN4)]. Again, we found no differences between animals housed with or without enriching material

(Fig. 4C). Although the immune response to mycobacteria depends to a great extent on the activation of the infected cells, essentially macrophages, by specific CD4+ T cells, other cell populations are also known to participate in this response [32]. Thus, we evaluated the click here total number of cells in the spleen as well as the most relevant spleen cell populations. As it has been described previously [32], the infection led to an increase in the total number of splenocytes (Fig. 5A). The increased cellularity of the spleen, present in the three time-points analysed, has been associated initially with the increased number of cells responsible for the innate immune response (macrophages, NK cells, and granulocytes) but also because of the increased number of cells responsible for the Rutecarpine acquired immune response (T and B cells), as previously described [32–35]. The T cell response to this strain of M. avium has been shown to reach its peak around 4 weeks of infection [23]. Although the number of these cells decreases progressively back almost to the numbers observed in non-infected mice, the increased numbers of macrophages are maintained [32–35]. Despite the predicted alterations on the numbers of the

different cell populations along with the infection, no major differences were observed between animals housed in the major different conditions here compared (Fig. 5B). Because T cell activation is typically used as a read-out for the quality of the immune response to mycobacterial infections, we have accessed the activation profile of these cells. To do so, the expression levels of two of the most common use T cell activation-associated markers were determined: CD62L and CD44. T cell activation is known to result in the down-regulation of CD62L and up-regulation of CD44. In accordance, an increase in the number of T cells with an activation profile was observed at 4 weeks post infection, especially for CD4+ T cells [36, 37].

Once controversial, the idea that PrPSc in individual cases might be composed of mixtures (or different types co-occurring) is now well recognized and accepted.[40, 70] There are probably

two phenomena at play here. One is the finding of different predominant types in individual samples from different parts of the brain or more rarely approximately equal amounts of type 1A and type 2A in the same sCJD brain samples. The other is the observation made using antibodies that specifically recognize type 1 or type 2 PrPres, that a minority type always accompanies a majority type in sCJD and vCJD, albeit at sub-detectable levels when conventional antibodies are used.[71-75] The former issue is more tractable and a consensus is beginning to emerge that when multiple brain sampling and sensitive co-detection AZD2014 concentration is performed on cohorts of sCJD cases, a plateau is reached at between 30–40% of cases showing co-occurrence. Our own data examining four regions (temporal cortex, parietal cortex, occipital cortex and thalamus) instead of frontal cortex only, shows a rise in detected co-occurrence from 3% to 24% of cases.[76] Interestingly, only very rarely did this re-analysis involve a change in the predominant

type found in the brain overall. Parchi et al. have offered a revised version of their 1999 sporadic CJD classification system that adds mixed type to the original “pure” types and have shown CYTH4 that the most common of these 12 sCJD subtypes can be recognized on histological Sirolimus grounds, without reference to biochemical analysis.[39, 40, 77] It will be interesting to see in the fullness of time whether this additional complexity reflects a more refined series of discrete clinicopathological

phenotypes or whether it is indicative of a spectrum of phenotypes depending on the spacio-temporal accumulation of PrPSc types set against the patient genotype.[78] The phenotypic complexity of the sporadic forms of human prion disease has increased with the report of a new sporadic human prion disease, termed variably protease-sensitive prionopathy (VPSPr) that is distinct from previously recognized sub-types of sCJD.[41, 79] There are no mutations in the open reading frame of PRNP. The patients have no known risk factors for the disease, but the disease is most common in the VV genotype, as opposed to sCJD, which is most common in the MM genotype. The neuropathology involves medium-sized vacuolation and characteristic microplaques. Durations of illness can be very long and this coupled with symptoms that do not conform well to CJD have prompted speculation that the condition may be under-ascertained.

2). These results are in contrast to the results obtained when DNA is used as a control (Fig. 5a) or when the target Idasanutlin mRNA expression is quantified using Northern hybridization (Fig. 5b). In contrast to RNA, DNA is preferred as a control for measuring intracellular

gene expression, because it is always present and is stable, and variation in the DNA level usually reflects proliferation of the bacteria: With DNA as a control, the relative gene expression is correlated solely to the expression and degradation of the target mRNA (two independent parameters). One disadvantage of using DNA as a control is that the number of chromosomes per cell may differ during different stages of the developmental cycle (chromosomal replication precedes bacterial proliferation). Also, the copy number of a certain gene may differ depending on the distance from the origin of replication (continuous replication leads to more copies of genes located close to the origin of replication compared with those situated far away). These problems can be overcome by measuring the amount of DNA and determining the number of bacteria at the time of interest. A large increase in the DNA content accompanied by an unaltered number of bacteria indicates the presence of multiple chromosomes, LY2109761 molecular weight which might affect the interpretation of gene expression. This was not the case in our study, because the number of bacteria

and the amount of DNA were practically unaltered between 2 and 14 h p.i. (Fig. 1). When using DNA as an internal expression control, it is also extremely important

to verify the quality of the isolated RNA, which can be achieved by Northern blotting with probes specific for different RNAs (as shown in Fig. 5b). Our results suggest that INP0010 does not specifically inhibit expression of T3SS genes. Instead, the decreased transcription initiation in the presence of INP0010 could be attributed to a general effect, where either the activity or the availability of the RNA polymerase is limited. The latter scenario was strengthened by the observation that expression of rpoA, encoding the α-subunit Branched chain aminotransferase of the RNA polymerase, was decreased when INP0010 was added. Consequently, this could limit the number of functional RNA polymerases in the bacteria. Alternatively, the presence of INP0010 could delay the onset of the transition from EBs to RBs, causing a reduced gene expression at 14 h p.i. The present study is the first to demonstrate the decay of transcripts of 10 different mRNA species in C. pneumoniae. Interestingly, we found that the half-lives of different RNA species varied dramatically at 14 h p.i. (Fig. 3, Table 2). In the future, measurement of transcript half-life will definitely be a valuable tool to aid full understanding of Chlamydia gene expression. This study follows gene expression during early developmental phases of C.

Our findings show that mesenchymal stromal cells from OA patients modulate T cells effectively, maintaining a regulatory phenotype in an allogeneic co-culture approach with T cells from young and healthy donors. We chose to use this approach in order to attribute findings in the co-culture to MSCs connected to the disease rather than using Tregs from OA patients who also may have been preconditioned. Because

of the unique ability of MSCs to escape allorecognition [34], allogeneic co-cultures are an adequate model for the investigation of MSC–lymphocyte interactions [24]. To our knowledge, this is the first study to report effective immunomodulatory capacities of MSCs from OA patients, and more specifically from OA synovium. Saracatinib clinical trial MSC–Treg interactions have been reported in other contexts than OA, most importantly in transplantation immunology [35]; however, correlating these findings to OA remains a challenge in this early phase of research. MSCs from healthy donors have been shown to recruit regulatory subsets from CD3+/CD45RA+ and CD3+/CD45RO+ fractions [24]. In these experiments, MSCs maintained FoxP3 expression and promoted CD127

down-regulation in purified Treg subsets. It is known that the suppressive effects of Tregs are lost when cultured ex vivo, and recent findings suggest that, with time, a shift of these cells will occur towards effector memory-like cells this website that produce IL-6, IL-17 and IFN-γ [36]. This effect can be prevented by co-culture with MSCs [25]. MSCs seem to not only promote CD4+ Treg generation, but also generation of CD8+ regulatory subsets [26]. In our experiments, we found that both FoxP3 expression and absence of CD127 expression was maintained in CD4+ T cells enriched in Tregs when co-cultured with MSCs. Our data thus support previous findings that FoxP3 is correlated inversely with CD127 expression [24, the 37]. The synovial

MSCs were able to effectively maintain the Treg proportions comparable to B-MSCs. These findings suggest that MSCs from OA patients effectively retain the Treg subpopulation, but do not recruit Tregs from the CD4+ fraction, as in the study by di Ianni et al. [24]. Whether this is related to the disease remains to be identified in future experiments; however, the differences observed may also be due to variations in the experimental setting. There is discussion as to whether OA affects MSC ability to differentiate into various tissues. The chondrogenic potential of MSCs has been reported to be reduced in advanced OA [38]; however, other studies suggest that the chondrogenic potential of MSCs from OA or rheumatoid arthritis patients is equal to MSC from healthy donors [39, 40]. To this day, whether or not OA affects MSC immunomodulatory potential is unknown.

We believe that our present experimental observations further support a possible benefit of MZR in the treatment of lupus nephritis. Poly IC was from Sigma (St. Louis, MO, USA). Primer oligo(dT)12–18, dNTP mix, and Moloney murine leukemia virus (MMLV) reverse transcriptase were purchased from Invitrogen (Carlsbad, CA, USA). SsoFast EvaGreen

Supermix was from Bio-Rad (Hercules, CA, USA). Oligonucleotide primers for polymerase chain reaction (PCR) were custom synthesized by Greiner Japan (Atsugi, Japan). Enzyme-linked immunosorbent assay (ELISA) kits for MCP-1, CCL5, fractalkine and IL-8 were from R&D Systems (Minneapolis, MN, USA). Dexamethasone (DEX) was from Roche Diagnostics BGB324 manufacturer (Basel, Switzerland). MZR was from Asahi Kasei Pharma Corporation (Tokyo, Japan). Tacrolimus (Tac) was from Astellas Pharma Corporation (Tokyo, Japan).

Normal human mesangial cells (MCs) were purchased from Lonza (Walkersville, MD, USA), and the cells were cultured according to the manufacturer’s protocol.[13-17] Poly IC was dissolved in phosphate-buffered saline (PBS) and the cells were treated with 2–50 μg/mL poly IC for up to 48 h.[13-17] In the experiments using immunosuppressive reagents, the selleck chemical cells were pretreated, with 1–100 μg/mL MZR, 10 μM DEX, or 5 μg/mL Tac, 1 h before the treatment with 30 μg/mL poly IC. We have already confirmed that viability of cells was not affected by the treatment of these reagents (not shown). To examine the effect of MZR in

more detail in this setting, the cells at the time of 16 h after the stimulation with 30 μg/mL poly IC were post-treated with 100 μg/mL of MZR for 24 h. Total RNA was extracted from cells using RNeasy RNA extraction kit. Single-strand cDNA was synthesized from 1 μg of total RNA using oligo(dT)12–18 primer and MMLV reverse transcriptase. The cDNA for MCP-1, CCL5, fractalkine, IL-8, or glyceraldehydes-3-phosphate dehydrogenase (GAPDH) was amplified using SsoFast EvaGreen Supermix, as reported previously.[13-17] The primers were custom-synthesized by Greiner Japan (Atsugi, Japan), and the sequences of the primers were as follows: MCP-1: -forward, 5′-AAACTGAAGCTCGCACTCTCGC−3′, reverse, Pyruvate dehydrogenase 5′-ATTCTTGGGTTGTTGAGTGAGT−3′; CCL5: -forward, 5′-CTACTCGGGAGGCTAAGGCAGGAA−3′, reverse, 5′-GAGGGGTTGAGACGGCGGAAGC−3′; fractalkine: -forward, 5′-GACCCCTAAGGCTGAGGAAC-3′, reverse, 5′-CTCTCCTGCCATCTTTCGAG-3′; IL-8: -forward, 5′-AGGAGTGCTAAAGAACTTCGA−3′, reverse, 5′-TGAATTCTCAGCCCTCTTCAA-3′, and GAPDH: -forward, 5′-GCACCGTCAAGGCTGAGAAC−3′, reverse, 5′-ATGGTGGTGAAGACGCCAGT−3′. Each sample was run in triplicate. The concentration of MCP-1, CCL5, fractalkine and IL-8 in cell-conditioned medium was measured in triplicate in each, using an ELISA kit according to the manufacturer’s protocol. Statistical significance was evaluated using the paired t-test.